Advertisement

Expression of BMP-7 and USAG-1 (a BMP antagonist) in kidney development and injury

      Once developed, end-stage renal disease cannot be reversed by any current therapy. Bone morphogenetic protein-7 (BMP-7), however, is a possible treatment for reversing end-stage renal disease. Previously, we showed that the BMP antagonist uterine sensitization-associated gene-1 (USAG-1, also known as ectodin and sclerostin domain-containing 1) negatively regulates the renoprotective action of BMP-7. Here, we show that the ratio between USAG-1 and BMP-7 expression increased dramatically in the later stage of kidney development, with USAG-1 expression overlapping BMP-7 only in differentiated distal tubules. Examination of USAG-1 expression in developing kidney indicated that a mosaic of proximal and distal tubule marker-positive cells reside side by side in the immature nephron. This suggests that each cell controls its own fate for becoming a proximal or distal tubule cell. In kidney injury models, the ratio of USAG-1 to BMP-7 expression decreased with kidney damage but increased after subsequent kidney regeneration. Our study suggests that USAG-1 expression in a kidney biopsy could be useful in predicting outcome.

      KEYWORDS

      Bone morphogenetic proteins (BMPs) are phylogenetically conserved signaling molecules that belong to the transforming growth factor-β superfamily.
      • Reddi A.H.
      Bone morphogenetic proteins and skeletal development: the kidney–bone connection.
      Although these proteins were first identified by their capacity to promote endochondral bone formation, they are involved in the cascades of body patterning and morphogenesis. Furthermore, BMPs play important roles after birth in the pathophysiology of several diseases, including osteoporosis, arthritis, pulmonary hypertension, and kidney diseases.
      • Massague J.
      • Chen Y.G.
      Controlling TGF-beta signaling.
      Bone morphogenetic protein-7 is a 35-kDa homodimeric protein, and kidney is the major site of BMP-7 synthesis during embryogenesis as well as in postnatal development. BMP-7-deficient mice die shortly after birth due to severe renal hypoplasia.
      • Dudley A.T.
      • Lyons K.M.
      • Robertson E.J.
      A requirement for bone morphogenetic protein-7 during development of the mammalian kidney and eye.
      ,
      • Luo G.
      • Hofmann C.
      • Bronckers A.L.
      • et al.
      BMP-7 is an inducer of nephrogenesis, and is also required for eye development and skeletal patterning.
      Mutant kidneys suffer gradual cessation of nephrogenesis, associated with a reduction in ureteric bud branching and loss of metanephric mesenchyme, indicating that BMP-7 is essential for survival and differentiation of mesenchymal cells in kidney development.
      • Dudley A.T.
      • Robertson E.J.
      Overlapping expression domains of bone morphogenetic protein family members potentially account for limited tissue defects in BMP7 deficient embryos.
      In postnatal life, many developmental features are recapitulated during renal injury, and BMP-7 has been shown to be important in both preservation of kidney function and resistance to injury. For example, BMP-7 inhibits tubular epithelial cell dedifferentiation,
      • Kalluri R.
      • Neilson E.G.
      Epithelial–mesenchymal transition and its implications for fibrosis.
      • Zeisberg M.
      • Hanai J.
      • Sugimoto H.
      • et al.
      BMP-7 counteracts TGF-beta1-induced epithelial-to-mesenchymal transition and reverses chronic renal injury.
      • Zeisberg M.
      • Shah A.A.
      • Kalluri R.
      Bone morphogenic protein-7 induces mesenchymal to epithelial transition in adult renal fibroblasts and facilitates regeneration of injured kidney.
      • Wang S.
      • Chen Q.
      • Simon T.C.
      • et al.
      Bone morphogenic protein-7 (BMP-7), a novel therapy for diabetic nephropathy.
      • Wang S.
      • de Caestecker M.
      • Kopp J.
      • et al.
      Renal bone morphogenetic protein-7 protects against diabetic nephropathy.
      mesenchyme transformation, and apoptosis stimulated by various renal injuries, and has an anti-inflammatory effect in models of both acute and chronic renal failure.
      • Gould S.E.
      • Day M.
      • Jones S.S.
      • et al.
      BMP-7 regulates chemokine, cytokine, and hemodynamic gene expression in proximal tubule cells.
      The local activity of endogenous BMP-7 is controlled not only by the precise regulation of its expression, but also by certain classes of molecules that bind to BMP-7, acting as positive
      • Lin J.
      • Patel S.R.
      • Cheng X.
      • et al.
      Kielin/chordin-like protein, a novel enhancer of BMP signaling, attenuates renal fibrotic disease.
      or negative regulators of BMP-7 activity in the kidney.
      • Massague J.
      • Chen Y.G.
      Controlling TGF-beta signaling.
      • Reddi A.H.
      Interplay between bone morphogenetic proteins and cognate binding proteins in bone and cartilage development: noggin, chordin and DAN.
      • Yanagita M.
      BMP antagonists: their roles in development and involvement in pathophysiology.
      • Yanagita M.
      Modulator of bone morphogenetic protein activity in the progression of kidney diseases.
      BMP antagonists function through direct association with BMP, thus inhibiting the binding of BMP to its receptors, and define the boundaries of BMP activity.
      Recently, we found that the product of uterine sensitization-associated gene-1 (USAG-1) acts as a kidney-specific BMP antagonist, and that USAG-1 binds to and inhibits the biological activity of BMP-7.
      • Yanagita M.
      • Oka M.
      • Watabe T.
      • et al.
      USAG-1: a bone morphogenetic protein antagonist abundantly expressed in the kidney.
      We further demonstrated that USAG-1-deficient mice are resistant to kidney injury, and that USAG-1 is the central negative regulator of BMP function in the adult kidney.
      • Yanagita M.
      • Okuda T.
      • Endo S.
      • et al.
      Uterine sensitization-associated gene-1 (USAG-1), a novel BMP antagonist expressed in the kidney, accelerates tubular injury.
      Because the interaction between BMP-7 and USAG-1 seems to play critical roles in the kidney, we analyzed the balance between USAG-1 and BMP-7 expression in kidney injury and development, and demonstrated the reciprocal relationship between USAG-1 and BMP-7 expression in kidney injury and development. Close examination of USAG-1 expression in developing kidneys further provided a clue to proximal–distal differentiation mechanism of nephron by demonstrating the possibility that each single cell in an immature nephron controls its own fate to become proximal or distal tubule cell. In addition, USAG-1 expression in the kidney biopsy could be a powerful diagnostic tool to predict renal prognosis.

      RESULTS

       Generation of USAG-1+/LacZ knock-in mice

      To facilitate the temporal and spatial analyses of USAG-1 expression, we generated in-frame USAG-1+/LacZ mice. In our previous work, the nuclear lacZ reporter gene that was knocked in
      • Yanagita M.
      • Okuda T.
      • Endo S.
      • et al.
      Uterine sensitization-associated gene-1 (USAG-1), a novel BMP antagonist expressed in the kidney, accelerates tubular injury.
      proved unsuitable for signal detection. In this work, the cytoplasmic lacZ reporter gene was used to replace the open reading frame of USAG-1 and create a novel knock-in allele (Figure 1a). While USAG-1+/LacZ mice showed no overt defects, USAG-1LacZ/LacZ mice presented the same teeth phenotype as observed in the original USAG-1 mutants.
      • Yanagita M.
      • Okuda T.
      • Endo S.
      • et al.
      Uterine sensitization-associated gene-1 (USAG-1), a novel BMP antagonist expressed in the kidney, accelerates tubular injury.
      In situ hybridization (ISH) of a USAG-1 antisense probe to whole embryos at E9.5 and adult kidney specimen confirmed that lacZ staining in USAG-1+/LacZ mice reflected authentic USAG-1 gene expression (Figure 1d).
      Figure thumbnail gr1
      Figure 1Generation of USAG-1+/LacZ knock-in mice by gene targeting. (a) Design of Sostdc1 (gene symbol for USAG-1) null allele with concomitant replacement by LacZ. Light gray arrows depict the two exons; black arrows indicate the coding sequence. The homology boxes used for bacterial homologous recombination (BHR) are depicted as white (hb5′ and hb3′). The entire coding sequence of Sostdc1 was replaced by LacZ/Neo, in a manner such that the initiating ATG of Sostdc1 became the ATG of LacZ. The reporter open reading frame (ORF), LacZ, is followed by an SV40 polyadenylation signal and SV40-derived associated sequence
      • Thimmappaya B.
      • Zain B.S.
      • Dhar R.
      • et al.
      Nucleotide sequence of DNA template for the 3′ ends of SV40 mRNA. II. The sequence of the DNA fragment EcorII-F and a part of EcorII-H.
      (purple boxes), whereas, the Neo ORF is followed by the mouse PGK polyadenylation signal and associated sequence
      • Adra C.N.
      • Boer P.H.
      • McBurney M.W.
      Cloning and expression of the mouse pgk-1 gene and the nucleotide sequence of its promoter.
      (yellow boxes). All of these elements are standard elements used by Velocigene.
      • Valenzuela D.M.
      • Murphy A.J.
      • Frendewey D.
      • et al.
      High-throughput engineering of the mouse genome coupled with high-resolution expression analysis.
      The replacement afforded into the Sostdc1 BAC by BHR is also translated in an identical manner into the mouse genome during targeting. Therefore, all the features shown above are also those present in the modified Sostdc1 locus in the targeted embryonic stem (ES) cells. (b) PCR genotyping of USAG-1+/+, USAG-1+/LacZ, and USAG-1LacZ/LacZ littermates. (c) Real-time RT–PCR analysis of USAG-1 mRNA in the kidneys of USAG-1+/+, USAG-1+/LacZ, and USAG-1LacZ/LacZ littermates. Expression of USAG-1 was normalized to that of GAPDH and expressed relative to that in USAG-1+/+ mice. (d) ISH of whole embryo and adult kidney section revealed a similar distribution of USAG-1 mRNA and lacZ transcripts. C, cortex; OM, outer medulla; IM, inner medulla; P, proximal tubule; G, glomerulus. Bar=100 μm.

       USAG-1 is expressed in distal tubules and overlaps with BMP-7 in distal convoluted tubules

      To further analyze the localization of USAG-1 expression in the kidney, we used several well-characterized segment markers. First, we clarified the segments in which well-known segment markers are expressed (Figure 2a). Tamm Horsfall glycoprotein (THP) was expressed in thick ascending limb. The calbindin D28K was expressed in distal convoluted tubules (DCTs) and connecting tubules (CTs). Using the antibody from Upstate, NaKATPase α-1 subunit was strongly expressed in thick ascending limb, DCT, and CT. AQP-1 was expressed in proximal tubules, descending thin limb, and possibly in ascending thin limb, while AQP-2 was expressed in the collecting ducts (CDs)
      • Sasaki S.
      • Fushimi K.
      • Saito H.
      • et al.
      Cloning, characterization, and chromosomal mapping of human aquaporin of collecting duct.
      and CTs as reported.
      Figure thumbnail gr2
      Figure 2USAG-1 and BMP-7 overlap in DCTs. (a) Schematic illustration demonstrating the expression of USAG-1, BMP-7, and other segment markers in the nephron. USAG-1 is expressed in thick ascending limb (TAL), DCTs, and in CTs, while BMP-7 is expressed in DCT, CT, and in CD. (b) Tubules positive for calbindin D28K are positive for LacZ transcripts in the kidneys of USAG-1+/LacZ mice. G, glomerulus. Bar=100 μm. (c) Tubules positive for THP in the cortex are positive for LacZ transcripts in the kidneys of USAG-1+/LacZ mice. (d) Tubules positive for THP in the cortex and medulla are positive for LacZ transcripts in the kidneys of USAG-1+/LacZ mice. OM, outer medulla. (e) Tubules positive for NaKATPase in the cortex and medulla are positive for LacZ transcripts in the kidneys of USAG-1+/LacZ mice. (f and g) Tubules positive for AQP-2 (f) or AQP-1 (g) are negative for LacZ transcripts in the kidneys of USAG-1+/LacZ mice. (h) Tubules positive for calbindin D28K are positive for LacZ transcripts in the kidneys of BMP-7+/LacZ mice. LacZ transcripts in the kidneys of BMP-7+/LacZ mice are also positive in CD and podocyte in glomeruli.
      Next, we analyzed the localization of USAG-1 in adult kidneys using these markers, and demonstrated that all the tubules expressing calbindin D28K or THP in the cortex expressed USAG-1 (Figure 2b and c). In the outer medulla, USAG-1 expression completely overlapped with THP (Figure 2d) and NaKATPase (Figure 2e), but not with AQP-2 (Figure 2f) or AQP-1 (Figure 2g). In addition, USAG-1 expression in the cortex did not overlap with AQP-2 (Figure 2f) or AQP-1 (Figure 2g), except for CTs, which were double positive for lacZ transcript and AQP-2 (data not shown). In the inner medulla, USAG-1 expression was not detected (Figure 1d). From these findings, we concluded that USAG-1 is predominantly expressed in the distal tubules, more specifically, in thick ascending limb, DCT, and CT in adult kidneys.
      For comparison, the expression of BMP-7 was determined using BMP-7+/LacZ mice, and the tubules expressing calbindin D28K (Figure 2h) or AQP-2 (data not shown) were positive for lacZ transcript, indicating that BMP-7 is expressed in DCT, CT, and CD as previously reported (Figure 2a).
      • Gould S.E.
      • Day M.
      • Jones S.S.
      • et al.
      BMP-7 regulates chemokine, cytokine, and hemodynamic gene expression in proximal tubule cells.

       USAG-1 emerges in developing nephrons and colocalizes with BMP-7 only in differentiated tubules

      Next, we examined the expression of USAG-1 and BMP-7 in kidney development. The expression of USAG-1 increased toward the later stage of development, and peaked at E17.5, while BMP-7 was constantly expressed during kidney development and decreased at perinatal period (Figure 3a). As a result, the ratio between USAG-1 and BMP-7 expression increased significantly toward the later stage of development (Figure 3a). We also compared the ratio between other BMP antagonists and BMP-7, and demonstrated that USAG-1 is predominantly the major BMP antagonist during kidney development (Figure 3a). At E13.5, USAG-1 expression was almost absent (Figure 3b), while BMP-7 expression was intensely expressed in ureteric buds, adjacent metanephric mesenchyme, and part of comma-shaped body (Figure 3c). At E15.5, USAG-1 expression was still absent in the comma-shaped body, but was strongly detected in more differentiated tubular epithelial cells in the medulla, in a pattern similar to that of BMP-7, except for the expression in the podocyte layers of the developing glomeruli, where USAG-1 expression was absent (Figure 3b and c). Therefore, we conclude that USAG-1 emerges in developing nephrons and colocalizes with BMP-7 only in differentiated tubules (Figure 3d). We also examined the expression of several segmental markers in USAG-1-deficient kidney to determine whether the developmental process is modified; however, we could not observe any difference in the expression pattern of these markers (data not shown).
      Figure thumbnail gr3
      Figure 3USAG-1 emerged in developing nephrons and colocalized with BMP-7 in differentiated tubules. (a) Expression of USAG-1 and ratio of USAG-1/BMP-7 expression increased in kidney development. Metanephric kidneys from five to six embryos at indicated time points, and kidneys from seven neonates were collected and subjected to RNA extraction. Expression levels of USAG-1 and BMP-7 were normalized to the expression of GAPDH and expressed relative to the expression level in the adult kidney. The ratio of USAG-1 and other BMP antagonists to BMP-7 expression was determined as described (see Materials and Methods). (b and c) Localization of lacZ transcripts in developing USAG-1+/LacZ (b) and BMP-7+/LacZ (c) kidneys. Expression of USAG-1/lacZ transcripts did not emerge in immature nephrons, where BMP-7 facilitates differentiation, but was strong and overlapped with that of BMP-7 in the fully differentiated tubules (arrowheads). Besides, the strong signal of USAG-1/lacZ transcripts in distal tubules (arrowhead), a weak, patchy signal was observed in the neonatal kidneys (arrows). UB, ureteric bud; M, mesenchyme; C, comma-shaped body; G, glomerulus. Bar=100 μm. (d) Schematic illustration demonstrating the expression of USAG-1 and BMP-7 during kidney development. USAG-1 expression was negative in the immature nephron, where BMP-7 was strongly expressed and promoted differentiation. USAG-1 expression emerged in more differentiated tubules and overlapped with that of BMP-7.

       Mosaicism of proximal tubule marker-positive cell and distal tubule marker-positive cell in a single immature nephron

      From E17.5 to the neonatal period, two patterns of USAG-1 expression were observed in the kidneys: a strong signal in distal tubules (Figure 3b, arrowheads) and a weak, patchy signal in the cortex (Figure 3b, arrows). To demonstrate that both signals were not due to endogenous β-galactosidase activity in the kidney, kidneys of wild-type mice were subjected to lacZ staining and incubated for the same period of time, but no signal was detected (Figure 3b).
      We further analyzed the property of these signals with segment markers, and found that the strong signal in neonatal USAG-1+/LacZ kidneys colocalized with THP and NaKATPase (Figure 4a and b), but not with AQP-1 or AQP-2 (Figure 4c and d). Calbindin D28K was hardly detected in the immature nephron at this stage. On the other hand, only the weak, patchy signal, but not the strong signal, colocalized with the expression of the lectin-binding sites for Lotus Tetragonolobus Agglutnin (LTA) (Figure 4e), the marker for proximal tubules.
      • Cho E.A.
      • Patterson L.T.
      • Brookhiser W.T.
      • et al.
      Differential expression and function of cadherin-6 during renal epithelium development.
      NDRG1, the cytoplasmic protein upregulated in several stress stimuli,
      • Okuda T.
      • Higashi Y.
      • Kokame K.
      • et al.
      Ndrg1-deficient mice exhibit a progressive demyelinating disorder of peripheral nerves.
      is known to be expressed in the proximal tubules and CDs in the kidney.
      • Wakisaka Y.
      • Furuta A.
      • Masuda K.
      • et al.
      Cellular distribution of NDRG1 protein in the rat kidney and brain during normal postnatal development.
      The weak, patchy signal of lacZ staining also colocalized with NDRG1 expression (Figure 4f), indicating that these tubules with weak, patchy signal of lacZ staining possess proximal tubule property, as well. AQP-1 was partially positive in the descending part of weak, patchy blue tubules (Figure 4d), possibly indicating that these tubules might have the characteristics of proximal tubules and thin limbs of Henle. Close examination of these tubules further clarified that the weak, patchy signal of lacZ staining and NDRG1 signals were not overlapping in a single cell, but were complementary in the single tubule (Figure 4g); therefore, the tubule in this area was made up of two types of epithelial cells: those with distal tubule property and those with proximal tubule property (Figure 4h). To exclude the possibility that lacZ staining quenches the fluorescence of other markers, immunostaining of the serial sections was performed and demonstrated similar results (data not shown).
      Figure thumbnail gr4
      Figure 4Mosaicism of proximal tubule marker-positive cell and distal tubule marker-positive cell in a single immature nephron. (a) Strong (arrowheads) and weak, patchy signal of lacZ transcripts in neonatal USAG-1+/LacZ kidneys colocalized with NaKATPase. Bar=100 μm. (b) Strong signal of lacZ transcripts in neonatal USAG-1+/LacZ kidneys colocalized with THP. (c) LacZ transcripts in neonatal USAG-1+/LacZ kidneys did not colocalize with AQP-2. (d) AQP-1 was partially positive in the descending tubules with weak, patchy signal of lacZ transcripts (arrow). (e) Weak, patchy signal of lacZ transcripts colocalized with lectin-binding sites for Lotus Tetragonolobus Agglutnin (LTA). (f) Weak, patchy signal of lacZ transcripts colocalized with NDRG1. (g) Close examination of the overlapping areas demonstrated that the weak, patchy signal of lacZ transcripts (arrows) was not overlapping with NDRG1 expression, but was complementary in a single tubule. (h) Working hypothesis for proximal–distal differentiation mechanism of kidney tubules. Proximal tubule marker-positive cells (green) lie side by side with distal tubule marker-positive cells (red) in a single immature nephron. It is postulated that each single cell possesses its cell fate to become proximal or distal tubular cell.

       The ratio between USAG-1 and BMP-7 expression was reduced in tubular injury and increased in tubular regeneration

      We also examined the expression of USAG-1 and BMP-7 in kidney injury. Administration of cisplatin causes acute tubular necrosis and apoptosis, leading to deterioration of renal function. USAG-1 but not BMP-7 mRNA in the kidney decreased at day 3 of cisplatin nephrotoxicity (Figure 5a). ISH and lacZ staining demonstrated that USAG-1 expression was significantly reduced at day 3 of cisplatin nephrotoxicity, while the lacZ staining in BMP-7+/LacZ mice was maintained (Figure 5c–e). At day 0 of cisplatin nephrotoxicity, the expression level of USAG-1 was much higher than that of BMP-7, but at day 3, the ratio between USAG-1 and BMP-7 expression was significantly decreased, indicating that the reduction of USAG-1 expression was more prominent than that of BMP-7.
      Figure thumbnail gr5
      Figure 5Expression of USAG-1 decreased in tubular injury. (a) Expression of USAG-1 mRNA decreased in acute tubular injury. Expression of USAG-1 and BMP-7 and the ratio between USAG-1 and BMP-7 expression during cisplatin nephrotoxicity (CN) were determined by real-time RT–PCR. Expression of USAG-1 and BMP-7 was normalized to that of GAPDH and expressed relative to that in mice on day 0. The ratio between USAG-1 and BMP-7 expression was determined by setting the standard curve with plasmids encoding each gene at various concentrations and analyzing the copy number of each gene contained in kidney cDNA (see Results). N=4–6 for each experiment. (be) Representative histological findings (b), ISH of USAG-1 mRNA (c), and lacZ staining of the USAG-1+/LacZ (d), and BMP-7+/LacZ (e) kidneys during CN. Bar=100 μm.
      Next, we examined the expression of USAG-1 in the kidney regeneration. Administration of folic acid (FA) to mice causes intratubular crystallization, which results in dilatation and degeneration of tubules, leading to transient acute renal failure
      • Long D.A.
      • Woolf A.S.
      • Suda T.
      • et al.
      Increased renal angiopoietin-1 expression in folic acid-induced nephrotoxicity in mice.
      (Figure 6a). In contrast to the cisplatin nephrotoxicity model, damaged tubular epithelial cells proliferate and regenerate after several days, and renal function returns to normal by day 14 (Figure 6a). Expression of USAG-1 in this model decreased during tubular epithelial damage (day 1), but increased markedly during proliferation and regeneration of tubular epithelial cells (days 7–10), and returned to the basal level when redifferentiation of tubular epithelial cells was completed (day 14), while the expression of BMP-7 increased gradually after the initial dip at day 1 (Figure 6b). ISH and lacZ staining demonstrated that USAG-1 was strongly detected in the irregularly lined regenerating tubular epithelial cells at day 10 (Figure 6d and e, arrows), which might account for the increase in USAG-1 expression at this time point (Figure 6b). The ratio between USAG-1 and BMP-7 expression was significantly increased during the regeneration phase (Figure 6b). We also compared the ratio between other BMP antagonists and BMP-7 in both kidney disease models, and demonstrated that USAG-1 is predominantly the major BMP antagonist during kidney injury (Figure S1).
      Figure thumbnail gr6
      Figure 6Expression of USAG-1 increased in tubular regeneration. (a) Time course of serum creatinine level in FA nephrotoxicity model. (b) Expression of USAG-1 and BMP-7 and the ratio between USAG-1 and BMP-7 expression after FA treatment. N=4–6 for each experiment. (cf) Representative histological findings (c), ISH of USAG-1 mRNA (d), and lacZ staining of the USAG-1+/LacZ (e) and BMP-7+/LacZ kidneys (f) after FA treatment. Bar=100 μm. USAG-1 was strongly detected in the irregularly lined regenerating epithelial cells (d and e; arrows).

       USAG-1 as a predictive marker for renal prognosis

      Because USAG-1 is a negative regulator of the renoprotective action of BMP-7, we postulated that high expression of USAG-1 in the kidney biopsy might predict poor renal prognosis.
      Because regenerating tubules and damaged tubules are observed in the regenerating period (days 7–10) of FA nephrotoxicity and might mimic the situation in the clinical kidney biopsy specimen, we utilized the model and performed kidney biopsy at day 7 and examined renal function at day 14. Interestingly, the expression of USAG-1 in kidney biopsy at day 7 correlated significantly with renal function at day 14 (Figure 7), indicating the possibility that USAG-1 could be a predictive marker of renal prognosis. We also performed renal biopsies at days 1 and 10. As shown in Figure S2, USAG-1 expression at day 10 (N=4, regenerating period) correlated well with future renal function at day 14, while USAG-1 expression at day 1 (N=8, tubular damage period) did not. Therefore, we conclude that USAG-1 expression correlated well with future renal function when tubular regeneration is observed.
      Figure thumbnail gr7
      Figure 7USAG-1 as a diagnostic marker for renal prognosis. A significant correlation is observed between USAG-1 expression in kidney biopsy sample at day 7 and serum creatinine at day 14 in FA nephrotoxicity (closed circle, N=23). Open circles indicate control kidneys without FA nephrotoxicity (N=4).

      DISCUSSION

       USAG-1 colocalizes with BMP-7 only in differentiated tubules in developing kidney

      During kidney development, BMP-7, made by both metanephric mesenchyme and tubular epithelial cells (Figure 3c), is a facilitator of ureteric bud branching at low concentrations, but an inhibitor of branching at high concentrations.
      • Gupta I.R.
      • Piscione T.D.
      • Grisaru S.
      • et al.
      Protein kinase A is a negative regulator of renal branching morphogenesis and modulates inhibitory and stimulatory bone morphogenetic proteins.
      The discrepancy is a part of a feedback mechanism that allows ureteric buds to branch into ‘unpopulated’ areas of mesenchyme, but not into areas already populated by nephrons and other bud branches. USAG-1 expression did not emerge in immature nephrons where BMP-7 facilitates differentiation, but was strongly expressed and overlapped with BMP-7 in fully differentiated tubules (Figure 3b and c). We also demonstrated that USAG-1 expression is lower than that of BMP-7 at E13.5, is comparable at E14.5 and E15.5, and is much higher at E17.5 and in newborns (Figure 3a). In addition, USAG-1 is the major BMP antagonist during kidney development (Figure 3a). These data support the idea that USAG-1 might function as a feedback mechanism for BMP-7 activity during kidney development. However, no developmental abnormality was observed in the kidney of USAG-1-deficient mice,
      • Yanagita M.
      • Okuda T.
      • Endo S.
      • et al.
      Uterine sensitization-associated gene-1 (USAG-1), a novel BMP antagonist expressed in the kidney, accelerates tubular injury.
      and some redundant factor might overcome the lack of USAG-1 in the kidney of USAG-1-deficient mice during development. Twisted gastrulation is one candidate for the redundancy, because the expression pattern is similar to that of USAG-1 and the expression level is the second highest among BMP antagonists to USAG-1 (Figure 3a).

       USAG-1 expression gives an insight into proximal–distal differentiation mechanism of immature nephron

      In spite of that USAG-1 expression was confined to distal tubules in adult kidney, weak, patchy expression of USAG-1 in neonatal kidneys colocalized with proximal tubular markers, such as lectin-binding site for Lotus Tetragonolobus and NDRG1 in the cortex. NaKATPase, another distal tubule marker, also colocalized with proximal tubular markers in the area (data not shown). AQP-1 was partially positive in the descending part of weak, patchy blue tubules, possibly indicating that these tubules might also have the property of proximal tubules and thin limbs of Henle. Close examination of the area double positive for proximal and distal markers further demonstrated that each single cell is not double positive for these two markers, but two types of cells positive for each marker intermingled with each other in a single tubule (Figure 4g and h). Little is known about the mechanism how uniform mesenchymal cells differentiate to a variety of cells, including glomerular epithelial cells, proximal tubular cells, and distal tubular cells, along the proximal–distal axis.
      • Dressler G.R.
      The cellular basis of kidney development.
      There has been a controversy between the following two hypotheses: gradient of growth factors brings the proximal–distal differentiation, or cell fate is determined for each cell. Recent studies revealed critical roles of Notch in the determination of proximal tubule cells and the fates of podocytes.
      • Cheng H.T.
      • Kopan R.
      The role of Notch signaling in specification of podocyte and proximal tubules within the developing mouse kidney.
      • Chen L.
      • Al-Awqati Q.
      Segmental expression of Notch and Hairy genes in nephrogenesis.
      • McLaughlin K.A.
      • Rones M.S.
      • Mercola M.
      Notch regulates cell fate in the developing pronephros.
      Our data might support the cell fate hypothesis because the proximal tubule marker-positive cell lies side by side with the distal tubule marker-positive cell in a single tubule (Figure 4g and h), and such chimeric tubule could not be made by the gradient of growth factors. From these findings, we postulate that each single cell possesses its cell fate to become proximal tubular cell or distal tubular cell. Further study is needed to clarify how these chimeric tubules differentiate to mature tubules (Figure 4h). Interestingly, all tubule epithelial cells positive for proximal tubule marker reside in the chimeric tubules in neonatal kidney, while some distal tubule marker-positive cells reside outside the area and are terminally differentiated (Figure 4a and c, arrowheads, H), indicating the possible sequence of differentiation.

       USAG-1 expression decreases in tubular injury and increases in tubular regeneration

      In the adult kidney, we demonstrated that the expression of USAG-1 colocalized with BMP-7 in DCTs (Figure 2a) and decreased in acute tubular injury (Figure 5). The reduction of USAG-1 expression in renal injury is not simply due to loss of tubular epithelial cells, because USAG-1 expression decreased rapidly in the very early stage of diseases, when morphological changes of tubular epithelial cells were not obvious (data not shown).
      During the recovery from renal failure, regeneration of tubular epithelial cells occurs via proliferation and redifferentiation of surviving renal cells.
      • Thadhani R.
      • Pascual M.
      • Bonventre J.V.
      Acute renal failure.
      In the FA model, USAG-1 expression decreased during tubular injury, increased markedly during the regeneration of surviving cells, and returned to the basal level after redifferentiation was completed (Figure 6b). In contrast, the expression of BMP-7 increased gradually to the basal level after the initial dip during tubular injury (Figure 6b), resulting in a significant increase in the ratio between USAG-1 and BMP-7 during regeneration. Further examination with USAG-1-deficient mice is needed to clarify the role of USAG-1 in the regeneration of kidney injury.

       USAG-1 could be a diagnostic marker for renal prognosis

      In the clinical setting, prediction of renal prognosis is difficult even with histological examination, because damaged tubules and regenerating tubules are mixed in the single specimen, and are indistinguishable by morphology. Because USAG-1 is a negative regulator of the renoprotective action of BMP-7, we postulated that high expression of USAG-1 during kidney diseases might be a sign of poor renal prognosis. Because the coexistence of regenerating tubules and damaged tubules in FA nephrotoxicity model resembles the situation of renal biopsy in patients, we utilized the model and proved that high expression of USAG-1 in kidney biopsy in regenerating period correlated well with poor renal prognosis. Because the expression of USAG-1 is confined to the kidney, serum concentration of USAG-1 might reflect the renal expression level of USAG-1. In that case, blood test for USAG-1 concentration might be enough to predict renal prognosis and is suitable for health examination.

      MATERIALS AND METHODS

       Derivation of USAG-1/LacZ mice

      To generate a null allele of Sostdc1 (gene symbol for USAG-1), the coding sequence was replaced with the coding sequence of the marker gene LacZ, using Velocigene technology, essentially as described (Figure 1a).
      • Valenzuela D.M.
      • Murphy A.J.
      • Frendewey D.
      • et al.
      High-throughput engineering of the mouse genome coupled with high-resolution expression analysis.
      PCR genotyping was performed in all subsequent studies to allow specific detection of the genotype (Figure 1b). The sequences of the primers used were as follows: primer A, CCTTCTCTGTGTTTTCACTCCG; primer B, TGATTCAGGGTGCTGTTGC; and lacZRev, CCGTAATGGGATAGGTCACG.

       β-gal staining and in situ hybridization

      β-gal staining and ISH were performed as described previously.
      • Yanagita M.
      • Okuda T.
      • Endo S.
      • et al.
      Uterine sensitization-associated gene-1 (USAG-1), a novel BMP antagonist expressed in the kidney, accelerates tubular injury.
      ,
      • Valenzuela D.M.
      • Murphy A.J.
      • Frendewey D.
      • et al.
      High-throughput engineering of the mouse genome coupled with high-resolution expression analysis.
      Probe for ISH was designed to contain the open reading frame with the following length and GC content: USAG-1, 1.0 kbp (GC 52.6%). Hybridization was detected using an anti-DIG AP conjugate (Roche, Basel, Switzerland) and NBT/BCIP solution (Roche).

       Histological studies and immunostaining

      The kidneys were fixed in Carnoy's solution, embedded in paraffin, and sections (4 μm thick) were stained with periodic acid-Schiff for routine histological examination. Frozen sections of the kidneys and primary kidney tubular cells were immunostained as previously described.
      • Yanagita M.
      • Arai H.
      • Ishii K.
      • et al.
      Gas6 regulates mesangial cell proliferation through Axl in experimental glomerulonephritis.
      Reagents utilized were anti-NaKATPase α-1 antibody (Ab) (Upstate, Billerica, MA, USA), anti-calbindin D28K (Sigma, St Louis, MO, USA), anti-Tamm Horsfall Protein Ab (Biomedical Technologies Inc.), anti-aquaporin 1 Ab (Chemicon, Temecula, CA, USA), anti-aquaporin 2 Ab (Calbiochem, Darmstadt, Germany), FITC-conjugated lotus tetragonolobus agglutinin (LTA) (Sigma), anti-LacZ Ab (Cappel, Solon, OH, USA), and anti-NDRG1 Ab.
      • Okuda T.
      • Higashi Y.
      • Kokame K.
      • et al.
      Ndrg1-deficient mice exhibit a progressive demyelinating disorder of peripheral nerves.
      For double staining, immunostaining was performed before β-gal staining, to avoid the possibility that the deposition of X-gal interferes with antibody binding to the antigen.

       Quantification of mRNA by real-time RT–PCR

      Real-time reverse transcription (RT)–PCR was performed as described previously.
      • Yanagita M.
      • Okuda T.
      • Endo S.
      • et al.
      Uterine sensitization-associated gene-1 (USAG-1), a novel BMP antagonist expressed in the kidney, accelerates tubular injury.
      Specific primers were designed using Primer Express software (Applied Biosystems, Foster City, CA, USA). To compare the expression levels of different genes, we used modified real-time PCR by setting the standard curves with plasmids encoding each gene at various concentrations, and analyzed the copy number of each gene contained in kidney cDNA as previously described.
      • Yanagita M.
      • Okuda T.
      • Endo S.
      • et al.
      Uterine sensitization-associated gene-1 (USAG-1), a novel BMP antagonist expressed in the kidney, accelerates tubular injury.
      Serially diluted cDNA or plasmids were used to generate the standard curve for each primer, and the PCR conditions were as follows: 50 °C for 2 min, 95 °C for 10 min, then 95 °C for 15 s, and 60 °C for 1 min for 40 cycles.

       Kidney disease models

      Cisplatin nephrotoxicity was caused as described previously.
      • Yanagita M.
      • Okuda T.
      • Endo S.
      • et al.
      Uterine sensitization-associated gene-1 (USAG-1), a novel BMP antagonist expressed in the kidney, accelerates tubular injury.
      Briefly, cisplatin (20 mg kg−1, Sigma-Aldrich) was administered by a single intraperitoneal injection to 8-week-old female C57BL/6J mice (SLC Japan, Shizuoka, Japan). FA nephrotoxicity was caused by a single intraperitoneal injection of FA (250 mg kg−1, Sigma-Aldrich) in 0.15 M NaHCO3 to 11-week-old male C57BL/6J mice. The kidneys were collected at days 0, 1, 4, 10, and 14, with at least three animals at each time point.

       Animal use

      All mice were housed in specific pathogen-free conditions. All animal experiments were performed in accordance with the institutional guidelines as well as the National Institutes of Health (NIH) guidelines.

       Statistical analysis

      All assays were performed in triplicate. Data were presented as mean±s.d. Statistical significance was assessed by analysis of variance, followed by Fisher's protected LSD post hoc test. Correlation was determined by Spearman's correlation analysis.

      ACKNOWLEDGMENTS

      We thank Drs Y Nabeshima, E Nishi, and T Nakamura for valuable comments and discussion; S Tahara and A Yoshioka for experiments not included in the manuscript; and A Hosotani for technical assistance. This study was supported by grants-in-aid from the Ministry of Education, Culture, Science, Sports, and Technology of Japan (177090551); a Center of Excellence grant from the Ministry of Education, Culture, Science, Sports, and Technology of Japan; a research grant for health sciences from the Japanese Ministry of Health, Labor and Welfare; a grant from the Astellas Foundation for Research on Metabolic Disorders; a grant from the Novartis Foundation for the promotion of science; a grant from Kato Memorial Trust for Nambyo Research; a grant from Hayashi Memorial Foundation for Female Natural Scientists; and a grant from Japan Foundation for Applied Enzymology.

      SUPPLEMENTARY MATERIAL

      Figure S1. Relative expression of USAG-1 and other BMP antagonists to BMP-7 in kidney disease models.
      Figure S2. Significant correlation was observed between USAG-1 expression and future serum creatinine (day 14) in case that kidney biopsy was performed at day 10 but not at day 1 in folic acid nephrotoxicity (closed circles).

      REFERENCES

        • Reddi A.H.
        Bone morphogenetic proteins and skeletal development: the kidney–bone connection.
        Pediatr Nephrol. 2000; 14: 598-601
        • Massague J.
        • Chen Y.G.
        Controlling TGF-beta signaling.
        Genes Dev. 2000; 14: 627-644
        • Dudley A.T.
        • Lyons K.M.
        • Robertson E.J.
        A requirement for bone morphogenetic protein-7 during development of the mammalian kidney and eye.
        Genes Dev. 1995; 9: 2795-2807
        • Luo G.
        • Hofmann C.
        • Bronckers A.L.
        • et al.
        BMP-7 is an inducer of nephrogenesis, and is also required for eye development and skeletal patterning.
        Genes Dev. 1995; 9: 2808-2820
        • Dudley A.T.
        • Robertson E.J.
        Overlapping expression domains of bone morphogenetic protein family members potentially account for limited tissue defects in BMP7 deficient embryos.
        Dev Dyn. 1997; 208: 349-362
        • Kalluri R.
        • Neilson E.G.
        Epithelial–mesenchymal transition and its implications for fibrosis.
        J Clin Invest. 2003; 112: 1776-1784
        • Zeisberg M.
        • Hanai J.
        • Sugimoto H.
        • et al.
        BMP-7 counteracts TGF-beta1-induced epithelial-to-mesenchymal transition and reverses chronic renal injury.
        Nat Med. 2003; 9: 964-968
        • Zeisberg M.
        • Shah A.A.
        • Kalluri R.
        Bone morphogenic protein-7 induces mesenchymal to epithelial transition in adult renal fibroblasts and facilitates regeneration of injured kidney.
        J Biol Chem. 2005; 280: 8094-8100
        • Wang S.
        • Chen Q.
        • Simon T.C.
        • et al.
        Bone morphogenic protein-7 (BMP-7), a novel therapy for diabetic nephropathy.
        Kidney Int. 2003; 63: 2037-2049
        • Wang S.
        • de Caestecker M.
        • Kopp J.
        • et al.
        Renal bone morphogenetic protein-7 protects against diabetic nephropathy.
        J Am Soc Nephrol. 2006; 17: 2504-2512
        • Gould S.E.
        • Day M.
        • Jones S.S.
        • et al.
        BMP-7 regulates chemokine, cytokine, and hemodynamic gene expression in proximal tubule cells.
        Kidney Int. 2002; 61: 51-60
        • Lin J.
        • Patel S.R.
        • Cheng X.
        • et al.
        Kielin/chordin-like protein, a novel enhancer of BMP signaling, attenuates renal fibrotic disease.
        Nat Med. 2005; 11: 387-393
        • Reddi A.H.
        Interplay between bone morphogenetic proteins and cognate binding proteins in bone and cartilage development: noggin, chordin and DAN.
        Arthritis Res. 2001; 3: 1-5
        • Yanagita M.
        BMP antagonists: their roles in development and involvement in pathophysiology.
        Cytokine Growth Factor Rev. 2005; 16: 309-317
        • Yanagita M.
        Modulator of bone morphogenetic protein activity in the progression of kidney diseases.
        Kidney Int. 2006; 70: 989-993
        • Yanagita M.
        • Oka M.
        • Watabe T.
        • et al.
        USAG-1: a bone morphogenetic protein antagonist abundantly expressed in the kidney.
        Biochem Biophys Res Commun. 2004; 316: 490-500
        • Yanagita M.
        • Okuda T.
        • Endo S.
        • et al.
        Uterine sensitization-associated gene-1 (USAG-1), a novel BMP antagonist expressed in the kidney, accelerates tubular injury.
        J Clin Invest. 2006; 116: 70-79
        • Sasaki S.
        • Fushimi K.
        • Saito H.
        • et al.
        Cloning, characterization, and chromosomal mapping of human aquaporin of collecting duct.
        J Clin Invest. 1994; 93: 1250-1256
        • Cho E.A.
        • Patterson L.T.
        • Brookhiser W.T.
        • et al.
        Differential expression and function of cadherin-6 during renal epithelium development.
        Development. 1998; 125: 803-812
        • Okuda T.
        • Higashi Y.
        • Kokame K.
        • et al.
        Ndrg1-deficient mice exhibit a progressive demyelinating disorder of peripheral nerves.
        Mol Cell Biol. 2004; 24: 3949-3956
        • Wakisaka Y.
        • Furuta A.
        • Masuda K.
        • et al.
        Cellular distribution of NDRG1 protein in the rat kidney and brain during normal postnatal development.
        J Histochem Cytochem. 2003; 51: 1515-1525
        • Long D.A.
        • Woolf A.S.
        • Suda T.
        • et al.
        Increased renal angiopoietin-1 expression in folic acid-induced nephrotoxicity in mice.
        J Am Soc Nephrol. 2001; 12: 2721-2731
        • Gupta I.R.
        • Piscione T.D.
        • Grisaru S.
        • et al.
        Protein kinase A is a negative regulator of renal branching morphogenesis and modulates inhibitory and stimulatory bone morphogenetic proteins.
        J Biol Chem. 1999; 274: 26305-26314
        • Dressler G.R.
        The cellular basis of kidney development.
        Annu Rev Cell Dev Biol. 2006; 22: 509-529
        • Cheng H.T.
        • Kopan R.
        The role of Notch signaling in specification of podocyte and proximal tubules within the developing mouse kidney.
        Kidney Int. 2005; 68: 1951-1952
        • Chen L.
        • Al-Awqati Q.
        Segmental expression of Notch and Hairy genes in nephrogenesis.
        Am J Physiol Renal Physiol. 2005; 288: F939-F952
        • McLaughlin K.A.
        • Rones M.S.
        • Mercola M.
        Notch regulates cell fate in the developing pronephros.
        Dev Biol. 2000; 227: 567-580
        • Thadhani R.
        • Pascual M.
        • Bonventre J.V.
        Acute renal failure.
        N Engl J Med. 1996; 334: 1448-1460
        • Valenzuela D.M.
        • Murphy A.J.
        • Frendewey D.
        • et al.
        High-throughput engineering of the mouse genome coupled with high-resolution expression analysis.
        Nat Biotechnol. 2003; 21: 652-659
        • Yanagita M.
        • Arai H.
        • Ishii K.
        • et al.
        Gas6 regulates mesangial cell proliferation through Axl in experimental glomerulonephritis.
        Am J Pathol. 2001; 158: 1423-1432
        • Thimmappaya B.
        • Zain B.S.
        • Dhar R.
        • et al.
        Nucleotide sequence of DNA template for the 3′ ends of SV40 mRNA. II. The sequence of the DNA fragment EcorII-F and a part of EcorII-H.
        J Biol Chem. 1978; 253: 1613-1618
        • Adra C.N.
        • Boer P.H.
        • McBurney M.W.
        Cloning and expression of the mouse pgk-1 gene and the nucleotide sequence of its promoter.
        Gene. 1987; 60: 65-74